Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14753A9
Clone ID IST14753A9
Vector VICTR76
Project tigm

Sequence tag IST14753A9BBF1
Sequence
CAGTCNAGAATGTAAANAAGGGGAGGTANTCCTGCCTTTGATNNNNCTGNCTATCCCTCTTTCTTCTCCCTCTTGGGGGT
TGAGCCAGGAAGCATCTTATTGGATTATAGGAGTCAAGATTCTGGTTTTGTGTTTTTAANCACATGGATTTNATATAANC
TACATCTATGCGCACAAATANCCNCNCACANAGCTCAAGTTTGTAATTTAAAAAGACATATAATGTCTCCCCCTGTNATA
AAGGCAANCNGNCGTTNNNGGATCTNAAGTGTCTGGTNNTGTCNGCNTGTTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14753A9HMF1
Sequence
CAGTCAAGAATGTAAAGAAGGGGAGGTAGTCCTGCCTTTGATCANCCTGCCTATCCCTCTTTCTTCTCCCTCTTGNNGGT
NNANNNAN
Sequence Type genomic DNA
Unitrap ID UNI9027

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109153208..109153287 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000303 (Cdh1) NM_009864 fizzy/cell division cycle 20 related 1 (Drosophila) Gene [Source:MGI (curated);Acc:Cdh1-001]


Sequence tag IST14753A9HMR1
Sequence
GANTGTACAGAATTGGAGGTCATGTCTGAGATGCCTTGCGTTTAANTTCCTACACTAAATAAAACATTCTTGGGATAGTT
GGGGGTGTTTGAATATGGACTAGACAGCAAATGATACTGTAAATCTCCTACCCATGANAACGGGCAGCATGGTTCAGAAG
GGGCATCAGGCATCTTATCCTGACTCATGGAATGCTTTGTTTTCCTAAATACTGACTTATTGTTTGGAATTGAACAAGCT
GGGGCTGGAAAGATGGCTCANCANTCAAAGGTGTGCACTGTTCTTGCANAGGACCCACATTCGGTTCCCAGCACCCATGT
TAGGTGGCTCANGANCNTCTGTAACTCCNCCTCTGGGGATCCNACNCCTTCTGGCCTCTAAATGTGTGCATGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109152820..109153212 369
 
EST/CDNA Est Name
  BY354194.1

 
Come back to gene BY354194.1


For any suggestions or comments, please send an email to unitrap@crg.es