Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15081G7
Clone ID IST15081G7
Vector VICTR80
Project tigm

Sequence tag IST15081G7HMR1
Sequence
ATAGCANAGTGGGCCCTTGACATTACGGTANAACCCCCTGCAAAGCTGANGTGCCTTGGGGACGGAGTGCAGTCTGGAGA
ATANGACAAAGACCGTGTCACCTGAACTCTGACCTGAGCGCTGGGGCAGCTCCTGATGGTGGGGAACCTTCTTGGGCTAC
AATGGTGTTTTTGATTCTCTGGACCAAATTATAGAGACTGACTGATGACGCTCAAAACTGTGGCCTCCANANGTCTGGCT
GGCCGAGGAGTGAGCGGAGAATGCTTAAAGCAAAGCTTACAAAGCCCTGGTACTTGATGGGAATTTGCCTATCTTCANAC
AGGACGCCTCNNNAAAAGATGGGAGAAGTGGGACGTN
Sequence Type genomic DNA
Unitrap ID UNI33103

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 99336009..99336361 330
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032470 (Mras) NM_008624 muscle and microspikes RAS Gene [Source:MGI (curated);Acc:Mras-001]


Sequence tag IST15081G7BBF1
Sequence
GTCTCTCTGACCTAACCCTGGCGTAGGGGCACTTGAGCTCTCCCACTGACCACACTAGACTGTCATTCAGTTTGTGCCCT
GCTTTCCAAGCAGAACAGGATTTGGCATGGAGCCTGACACATGATGGGCACCGGGCCGCATCAGTTTAACGAGCGCAGGC
CCCAGTGGTGACCAGAGAGCCAGCCCAGCAACCCGAACCCAGGACGCAGTGAAGAGTTGTTTATGAAGAAAGCGGTTTTG
TATTATCCNCATGAATGTACCACCTCTCCGTAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 99336375..99336651 275
 
EST/CDNA Est Name
  BY309786.1 - BY323181.1 - BY008155.1 - BY327691.1

 
Come back to gene BY309786.1 - BY323181.1 - BY008155.1 - BY327691.1


For any suggestions or comments, please send an email to unitrap@crg.es