Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15062E9
Clone ID IST15062E9
Vector VICTR80
Project tigm

Sequence tag IST15062E9HMF1
Sequence
NTTGAATTGAGTGCAATGTCCAGGCTGTCCCTGTACAGTAAGACCTCTGTGTGTATCTGTACTGATTTTCTCAGTGCATG
CCATTATACCCACAGACTGTACACCACAAGTACCTGTCACAGTGCAGTTCAGTCATTATGGAGCAGGTGAAGGAATATGG
CAGAAGGTAGGTAGTGGCAATGGGAAAGGCTCAGTTGTCACACACATAGGTAGTAGATGGGAAAGATGAATGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11849917..11850147 231
NO GENE  


Sequence tag IST15062E9HMR1
Sequence
AGGGTTTCTGATTANANCCCNTGATGTGGAACCACCATACAGTGCATAAACTANATAGTAAGGCTTTGAAAAGAACTAGA
ACAAGAGCGCCTTATTTGAGGAAGTANAAAAGAGGACACCCATGCATATATAGCCTTCTGATGGCAATATTTCTGTCCCT
TTCTTTGTTCTTTTCTCAGTCATTTTAAAAGTATACTAGTGTACTTTAAAACTAATAGTATTTTATTTTGAAGTCAAACT
AAAATGGGGAAAATATAAAAGAAAGAATAAATGAAATTATTTTAAAAGAAACAGGAACCTTTGGGTTAAATTTTGACAAA
AAAGAAATTAATGAGCCTCACAAAGCCAGAATCTAGAAGAACTGCATATGTGTTTAG
Sequence Type genomic DNA
Unitrap ID UNI10095

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11849541..11849917 367
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020176 (Grb10) NM_010345 growth factor receptor bound protein 10 Gene [Source:MGI (curated);Acc:Grb10-005]

 
Come back to gene ENSMUSG00000020176


For any suggestions or comments, please send an email to unitrap@crg.es