Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST430955
Clone ID OST430955
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST430955
Sequence
GTTTGAACAGGTAACCAGCANTGAGGACCTGNCTTTCCCANTGGAGAACCCCTACAAGGAGCCTCTTAAGAAGTGTGTCT
TGTGTGAGAAACGTGTAGATTACAANGAATGTGCAGCTTTTGTCCCAGTTTATTTCTCCATTTACCGGATGCATTTATGG
AAGGCACATAACAGGTCTTTGTGGAAAGAAACANATGGAAATAACTAAAGCCATTAAGAGAGCTCAGAAAATGGGGTTTA
TGCCAGTTACATACAAGGATCCTGCATATCTCAAAGACCCTAGAGTTTGTAACATCAGATACCGAGAATAAATTTTGTAT
TTGTGAAGTTCCTGCCAATAAACCTCTAAGTGGTTGTCAGCAGACTCCAACTAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI18069

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 101228602..101233490 141
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000016833 (Mrps18c) NM_026826 mitochondrial ribosomal protein S18C Gene [Source:MGI (curated);Acc:Mrps18c-002]

 
Come back to gene ENSMUSG00000016833


For any suggestions or comments, please send an email to unitrap@crg.es