Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11609A11
Clone ID IST11609A11
Vector VICTR76
Project tigm

Sequence tag IST11609A11HMF1
Sequence
CTGTTCACAGACTGTGGCACGAACATCCCACTGCCTCAATAGTCAGGGATAGGTCTGACTTGATCTTGAATCCATATAAG
CTAGTCACACTGGCCTTCCTCTCCCCATCCTGAGTCATGCTACCATTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 25889434..25889562 129
NO GENE  


Sequence tag IST11609A11HMR1
Sequence
NNNCNGAACTANGGTTCAGCCGGTANCATGTANGGTGGAATNANAACTGGGGTGCCCCAGGCCATCCTCNANAGCTATGG
CCCAGAAAATTCTGAGATGCGTGCCCTGGTCTCCCGGCAGCTGCGTTGTCTGGCACGTCGCCTTCCTAGGCACCTCACCG
ACGAGGAACTGAATGCTCTTCCACTGGACCTGCTGCTCTTCCTCAAGTAGGCCTCAAGCTGGGAACTTGGTCTCATCCCC
CCCTTTGTCTAGCCCTGGGCTACAATGTGCAGTGACTGGGTGGCTTTGTCAGGGAGGTACTTAGTGGANTATCGTGTGTG
TGTGTGTGTGTGTGTGTGTGTGTNTNNNTNNNTN
Sequence Type genomic DNA
Unitrap ID UNI24772

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 25889097..25889434 322
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063011 (Msln) NM_018857 mesothelin Gene [Source:MGI Symbol;Acc:MGI:1888992]

 
Come back to gene ENSMUSG00000063011


For any suggestions or comments, please send an email to unitrap@crg.es