Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13682C8
Clone ID IST13682C8
Vector VICTR74
Project tigm

Sequence tag IST13682C8HMR1
Sequence
NCTAAAGACAAAACTCNAATCGTAGGATAATTTTGTTNATTTATTTGCTTTCTTTAAGGAAAGCGTGATCTGTTAGGTGA
CATTAAAAGCCNGGACTTTCCGCAGTTTCTAACTTAATATGTGTTACGAATCTGTTACCTGTATCAGTATTTTCATACTT
AGGCTGGCCCTGTGTGTGTGGACCGCAAGTGTGGAGCCAGTGGAGCCTCTAAATTCGTTCGGGTTTGGGAACAGGGTACC
TGCCCTTGGATTCTTTAAGCACCGTGCCGCACAATCTCTTTGCCCCAGCAGCCTCCTTGCTAGTCTCTTAACCAATTTAA
GTGCTCAACCCTTGACATTTTTTTCATGACCACTCTCATGTTCCTGTTATGTGAGATATCCTTCGTTTCTACTCCTCTGT
TATTCCACTGTGTACTGCTGTAACTAGTCTACTGTCGAATGTTANACTCTNTGCTTTACTTTTCCCCCTCCTTGCTTAAT
TGTNTANNGCNCTNGN
Sequence Type genomic DNA
Unitrap ID UNI29866

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 181256177..181256667 470
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000826 (Dnajc5) NM_016775 DnaJ (Hsp40) homolog, subfamily C, member 5 Gene [Source:MGI (curated);Acc:Dnajc5-001]

 
Come back to gene ENSMUSG00000000826


For any suggestions or comments, please send an email to unitrap@crg.es