Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14939E12
Clone ID IST14939E12
Vector VICTR76
Project tigm

Sequence tag IST14939E12BBF1
Sequence
CCAGTAGCTATATTTCATGCATAAAATTGTGTATATCATCATTTATTTGTACCATCCTTTTATAAATTATATTCTATACC
TATGTCGGGGGGAAAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI32138

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 76646218..76646317 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051747 (Ttn) NM_011652 titin Gene [Source:MGI (curated);Acc:Ttn-019]

 
Come back to gene ENSMUSG00000051747


For any suggestions or comments, please send an email to unitrap@crg.es