Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14560E11
Clone ID IST14560E11
Vector VICTR74
Project tigm

Sequence tag IST14560E11HMF3
Sequence
GTCTGCATGTCTACTTCCTTGTTCTGTCACTCGGTTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 61299792..61299828 37
NO GENE  


Sequence tag IST14560E11BBF2
Sequence
GTCTGCATGTCTACTTCCTTGTTCTGTCACTCGGTTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 61299792..61299828 37
NO GENE  


Sequence tag IST14560E11HMR1
Sequence
NCCAACAGCATGGGTGGCTGCTTGCATGAGGGTTGGTGGCCCCATGGCCTTGGTTCCCAGCCCATCATCACATTCCTGTC
TTCCCTTGGACTCCCAAAGGGGTTCTGATAGGAGAGCCTGGGCCAGGCCTGCAGGGGTATGAGCAAGACAGGGGAGGGGG
AATTCTCAAGCCTGACCTTACTCTGTCTTGAGTTGGTCCTTTCTTTTGAGAAATTATTACAGGGTGGCCGCNNGGTGGAN
AATAAGTTATTCCTTCTGGCATCCCGGAGAAGTGATGATTTTTCAGTGTGGATGCATTAAGTTCTTTNANTCTTGTTTTG
TTGGAGAGCANACCTTTCAAGCNNCTTATTCCCTTAGTGTTTCTTTCNCNTN
Sequence Type genomic DNA
Unitrap ID UNI32392

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29687264..29687629 350
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042203 (Tbc1d22b) NM_198647 TBC1 domain family, member 22B Gene [Source:MGI Symbol;Acc:MGI:2681867]

 
Come back to gene ENSMUSG00000042203


For any suggestions or comments, please send an email to unitrap@crg.es