Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST430909
Clone ID OST430909
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST430909
Sequence
TGAGTAGTGAACATCGGGAAGAAGCTCTACGAGGGTAAAACAAAAGAAGTCTATGAGTTGTTAGACACCCCAGGCAGAGT
CCTCCTGCAGTCCAAGGACCAGATCACAGCAGGGAATGCAGCTAGGAAGAACCACCTGGAAGGCAAAGCCGCCATCTCCA
ACAAGATCACCAGCTGCATATTTCAGTTGTTACAGGAAGCTGGTATAAAAACTGCTTTCACCAAGAAATGCGGGGAGACT
GCTTTCATTGCACCCCAGTGTGAAATGATCCCCATTGAGTGGGTGTGCCGAAGAATAGCAACTGGGTCTTTCCTCAAAAG
GAACCCTGGGGTACAGGAGGGGTACAAGTTCTATCCACCCAAAGTGGAGATGTTCTTCAAGGACGATGCCAATAATGATC
CACAGTGGTCTGAGGAGCAACTCATTGCTGCAAAATTCTGTTTTGCTGGCCTTGTTATAGGGCAGACTGAAGTGGACATC
ATGAGTCATGCCACACAAGCTATTTTTGAAATTCTGGAGAAATCCTGGCTGCCCCAGGACTGTACGCTGGTTGATAT
Sequence Type mRNA
Unitrap ID UNI17853

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 77385569..77390310 202
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029247 (Paics) NM_025939 phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoribosylaminoimidazole, succinocarboxamide synthetase Gene [Source:MGI (curated);Acc:Paics-001]

 
Come back to gene ENSMUSG00000029247


For any suggestions or comments, please send an email to unitrap@crg.es