Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST430802
Clone ID OST430802
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST430802
Sequence
CTGCAGACTTTTGTAGGNCNAACTTCTCAAGCTGAGACTGAGCAGAAAATCAAGGNTTACAATGGCCAGATCAACNGCAA
CCTCTTCATGAGCCTGAATAAGGATGGCTCCTACACAGGCTTCATCAAGGTTCAGCTGAAACTAGTGCGTCCTGTTTCAG
TGCCTTCCAGCAAGAAACCACCTTCCTTACAGGATGCCCGGAGAGGTACGGGGCNTTTTTNCAGCCGTGAAGCGCCGCAC
CTCTTTTTACTTGCCTAAGGATGCTATTAAGCATCTGCATGTTCTATCACGAACACGGGCACGTGAGGTCATTGAGGCCC
TGCTTCGAAAATTCATGGTCGTAGATGATCCTCGCAAGNTNGCACTCTTTGAGCGAACTGAACGGCATGGCCAAGTATAC
CTCCGGAAGCTGNCGGATGACGAGCAGCCCTTGAAGCTGCGGCTTCTTGCAGGGCCCAGCGAAAAAGCCCTGAGCTTTGT
CCTGAAGGAAAATGACTCGGGAGAGGCGA
Sequence Type mRNA
Unitrap ID UNI18078

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 107459816..107460631 278
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000010067 (Rassf1) NM_019713 Ras association (RalGDS/AF-6) domain family member 1 Gene [Source:MGI (curated);Acc:Rassf1-002]

 
Come back to gene ENSMUSG00000010067


For any suggestions or comments, please send an email to unitrap@crg.es