Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST430770
Clone ID OST430770
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST430770
Sequence
CTGTGCCTCTGGAGTGCTACACAGGAGCCTGCTGAAGAAGCCTGCCTCTCCTTCAGCTCTACTTCCGGGCCTTGGTTACT
GGCTCACTNCGTGCNCGNTGGTGCCCCATCCTNTACACTGTAGCCGTGGCTCATGTCAACAGTTTCATCTTCTGCCAAGA
CCCAAAGAGCTCAGATGAGGTAAAGACTGCCCGAAGGAGNATGCTGCAGAGAACGTGGCTGCTGACAGATGAGGGGCTGC
GGCAGCATCTCCTCCACTATAAGCTTCCCAACTCCAGCCTCCCAGAGGGCTTTGAGCTGTATTCCCAGTTACCTCGCCTG
AGGCAGCAGTGCCTTCAGACACTGCCCACAGAGGGGCTCCAGAATGGAGGAGTCAAGACATAGGGCACTTGCCCCCAGCT
AAAGATGACTACTCTACTCTCCTGGGACTGAGCAGTGAGCCTCCCGAGAGAAGGCAACACAAGACTTGCCTTCCTGTGAG
CACATTGTTTGAGCCTTTTTTAGAACAGAAGAGACTCGTATTACATCATGATACTGTGGGTAGCCCCCC
Sequence Type mRNA
Unitrap ID UNI18079

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 119589878..119590647 303
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034032 (Rpap1) NM_177294 RNA polymerase II associated protein 1 Gene [Source:MGI (curated);Acc:Rpap1-006]

 
Come back to gene ENSMUSG00000034032


For any suggestions or comments, please send an email to unitrap@crg.es