Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12103G6
Clone ID IST12103G6
Vector VICTR76
Project tigm

Sequence tag IST12103G6BBF1
Sequence
TTTTCTGAGTTCGAGGCCAACCTGGTCTACAAAGTAAGTTCCAGGACAGCCAGGGNTACACAGAGAAACCCTGTCTCGGA
AAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI6955 UNI10074 UNI32108 UNI35779 UNI36681

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 82287848..82287936 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3136896..3136984 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 8993158..8993246 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3867910..3867998 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 22332122..22332210 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 10011022..10011110 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 18691889..18691977 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 48285704..48285792 83
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 136057880..136057968 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001089 (Luzp1) NM_024452 leucine zipper protein 1 Gene [Source:MGI (curated);Acc:Luzp1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 118661812..118661900 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032850 (Tmem118) NM_172998 ring finger protein, transmembrane 2 Gene [Source:MGI (curated);Acc:Tmem118-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3639540..3639628 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035596 (Leng4) NM_029934 membrane bound O-acyltransferase domain containing 7 Gene [Source:MGI (curated);Acc:Leng4-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 13765651..13765739 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038416 (Cdc16) NM_027276 CDC16 cell division cycle 16 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Cdc16-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 20391491..20391579 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058192 (2210010B09Rik) NM_172919 RIKEN cDNA 2210010B09 gene Gene [Source:MGI Symbol;Acc:MGI:1924012]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 131451352..131451440 83
NO GENE  


Sequence tag IST12103G6HMF2
Sequence
TTTTCTGAGTTCGAGGCCAACCTGGTCTACAAAGTAAGTTCCAGGACAGCNAGGGCCATACAGAGAAACCCTGTCTCGGA
AAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 11280529..11280611 81
NO GENE  

 
Come back to gene ENSMUSG00000058192


For any suggestions or comments, please send an email to unitrap@crg.es