Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14149E4
Clone ID IST14149E4
Vector VICTR74
Project tigm

Sequence tag IST14149E4HMF1
Sequence
GGCCGGGGGAANGAACCCGGGAGTCNCTCTCATCGCCNGGAANCGGCCCCTGCCCACCGGGCCCNCCNCCCGGAACCCTG
GCCAGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14149E4HMR1
Sequence
GAAAGAGCTGGCTTTCAAAGCAGCAATTTTAAGTGGTGTTCCTGTGAGTGACGCTGCANTGACTAACACACAGGCTTCCT
GCAGTTCCGCTGTGCATGACTGGTAACAGAAGGTCAGACTTTCAGAACTGCATCTCAATGGCTGTACTTTTTATTATGCC
TCTTACATCTCCCCTANTACACACACACACACACACACACACNCNNGCNATTTACTCATNTAN
Sequence Type genomic DNA
Unitrap ID UNI36682

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 76342631..76342852 208
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042359 (Osbpl6) NM_145525 oxysterol binding protein-like 6 Gene [Source:MGI (curated);Acc:Osbpl6-001]

 
Come back to gene ENSMUSG00000042359


For any suggestions or comments, please send an email to unitrap@crg.es