Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14647B4
Clone ID IST14647B4
Vector VICTR74
Project tigm

Sequence tag IST14647B4HMR1
Sequence
AANNNNCTTCAGGAATATGGCCTTACTTTTTGCACTGGTTAGCTCAGTGTTTTATCACACCAGTTTACCATAATGTACTT
CTTGGTGTCTGTATATTATAGAGCATAAACTTTAGGTCAGGACTCATGCCTTAGTCATTTCCCTATCATGAGTTGGGTAT
CACTGTTTGATGAACAAAAGAGCTAATGAAGAATTATGATGGCGACATTCCACGAGGTTAGGGTTGTGGAAAGGAAGGGA
GGGCACGTGACTCCGTGCTCNCACAGTACCTANCANGTGACTNNGGCTCANCAACCATTGGTTGAACAAATGGATGANAC
CGTTGANCCAAACCGCATTCTGAAACTTGAAGATACCACTCCNTGGTTCTGCTTACATTTCCTGCCNACATCGGTTCTCT
GACCCNTGTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117031267..117031670 382
 
EST/CDNA Est Name
  CA463153.1


Sequence tag IST14647B4BBF1
Sequence
CTTTGAGCATGTCTTTTTAAAAATATAATGTTTTAAGGCTGGGGAAAGGCTTGTGGGCATAAACACTCACTGGGCAAGTG
TAAGGATCT
Sequence Type genomic DNA
Unitrap ID UNI19527

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117031177..117031264 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]


Sequence tag IST14647B4HMF1
Sequence
CTTTGAGCATGTCTTTTTAAAAATATAATGTTTTAAGGCTGGGGAAAGGCTTGTGGGCATAAACACTCACTGGGCAAGTG
TAAGGATCCAAGTTCAGACCTTCAGCACATACAGAAAAGTTGGACGTGACAGACTAAACACATAACACCCCCCCCCCC
Sequence Type genomic DNA
Unitrap ID UNI19527

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117031108..117031264 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]

 
Come back to gene ENSMUSG00000028677


For any suggestions or comments, please send an email to unitrap@crg.es