Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12484E7
Clone ID IST12484E7
Vector VICTR76
Project tigm

Sequence tag IST12484E7HMF1
Sequence
CCAGGACAGCCAGGGCTATACAGAGAAACCCTGTCTCAAAAACCAAAATAAAATAAAATAAAATAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12484E7BBF1
Sequence
CCAGGACAGCCAGGGCTATACAGAGAAACCCTGTCTTGAAAAAACAAAAACAAAAAAACCCCCAAAAAACAAACAAACAA
AAAAGAATGTAATATTTTTTGTTTGTTTTTGAGAGAGGGTTTCTCTGTGCAGCCCTGGCTCTTCTGGAACTCACTCTGTA
NATCATGCTGGCCTTGAATTTAGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI15829

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 38753651..38753840 188
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063972 (Nr6a1) NM_010264 nuclear receptor subfamily 6, group A, member 1 Gene [Source:MGI (curated);Acc:Nr6a1-001]

 
Come back to gene ENSMUSG00000063972


For any suggestions or comments, please send an email to unitrap@crg.es