Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14159C8
Clone ID IST14159C8
Vector VICTR74
Project tigm

Sequence tag IST14159C8HMF2
Sequence
CAAGAAGCNNNNNGGGNNANGAAAGGGTTTATTCGGCTTACACTTCCATACTGCATTCATCANNNNGGAAGTCAGGACTG
GAACTCAAGCAGGTCAGGAAGTAGGAGCTGATGCAGAGGCCATGGAGGGATGTTCTTTACTGACTTGCTTCCCCTGGCTT
GCTCAGCCTGCTCTCTTATAGAACCAAGACTGCCAGCCCAGAGATGGTCCCACCCACAAGGGGCCTTTCCCCCTTGATCA
CTAACTGAGAAAATGCCCTACAGCTGGATCTCATGGAGGCATTTCCTCAACTGAAGCTCCTTTCTCTGTGATAACTCCAG
CTGTGTCAAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115495997..115496327 306
NO GENE  


Sequence tag IST14159C8BBF1
Sequence
CAAGAAGCAANANGGNNNAGGAAAGGGTTTATTCGGCTTACACTTCCATACTGCATTCATCACCAAGGAAGTCAGGACTG
GAACTCAAGCAGGTCAGGAAGTAGGAGCTGATGCAGAGGCCATGGAGGGATGTTCTTTACTGACTTGCTTCCCCTGGCTT
GCTCAGCCTGCTCTCTTATAGAACCAAGACTGCCAGCCCAGAGATGGTCCCACCCACAAGGGGCCTTTCCCCCTTGATCA
CTAACTGAGAAAATGCCCTACAGCTGGATCTCATGGAGGCATTTCCTCAACTGAAGCTCCTTTCTCTGTGATAACTCCAG
CTGTGTCAAGTTGACACAAAACTAGCCAGTACACAAAGATATACTTTCGCTGCATTTTAGCAACCTTGACATTGAAGTAC
ATTTTNAAATTGGCAGCATATTTTTTCTTTAGTGACATACAAANAATGGGTCATTTAAAATCAATTTTCAATTANTTGAA
ACNAATGATGTTNATACCACTGANTTCAAATNNNCTGCATTTCAACTAANCNNCTGCTTGCAGTGTATGATGTGTAGACC
TTGANNATNAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115495764..115496327 523
NO GENE  


Sequence tag IST14159C8HMR1
Sequence
TTTGGTCNTGATGTTTGTGCAGGAATAGAAACCCTGACTAAGACACTTTGTTAATGCTATTTCTTCTGTGTTTGGCGTTT
GTCTCCCATTTCTTTTAGCCGGTTGAAGGGATAATTGTTACGTGTTATTGAGAACTATAC
Sequence Type genomic DNA
Unitrap ID UNI29650

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115496325..115496462 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029550 (Sppl3) NM_029012 signal peptide peptidase 3 Gene [Source:MGI (curated);Acc:Sppl3-001]

 
Come back to gene ENSMUSG00000029550


For any suggestions or comments, please send an email to unitrap@crg.es