Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14621B10
Clone ID IST14621B10
Vector VICTR74
Project tigm

Sequence tag IST14621B10BBF1
Sequence
CTGCACACCGTGGTACTCACACCCACGTCACACACACTCACAACCACAAGGATAACAAACAATTGTAAAATTTAAAACAA
GAGCATCATAGACTAGGTGCTACTCTATTCAAAAATGCCCTTCGCCCACACTCACAGACACAAGTTCCACATTCTTTTGC
TGTTTTTCACTGGAGAGAAGTTTTATTTGGAAAACGAGTTGTTTGTTTTTTAAATTGTGAAACCCATGCTGACCTCTAGG
TTCCAGCAATCCTCCTGCCTCAGCCAGAGTACAAGCACCAAGTTCAGTGCCTATAAATTTTTTATCTTTATTATATTTAC
TTCATGTCTATGTGTGGCATGCAAGTAAAGGTCAAGGACCACTGATGGGAGTTGTTTCTCTCCTCTACNNTGTGTGCTCC
GTGATCTCAGGTAATCANGCTTGCCNGTGANNACNNNNNNNNNNTCTCACTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 30905206..30905635 422
 
EST/CDNA Est Name
  BB702083.1 - BB617430.1 - BB644308.1 - CJ179202.1 - AA242725.1 - BY244103.1 - BI684042.1 - BF538044.1 - BI690464.1 - BF142490.1


Sequence tag IST14621B10HMR1
Sequence
CCGTTTTCTCCTAAAGCCTTTTGGTGGTTTCTGTTCATGGAACTCTGTCATGCTTGCATGTTAAATGTTTTTATATGCTG
AGCTATTTCTGTCCTTACTTGCTTTTTTATGTGAAGAATTCATGAAGTGTTTTTCTGAACTTGCTTTTATGTTGGTCTAA
TTGACTCCATAATTATTAACGTTTTTCTGTCAAGAANAGCANTGANTGATNNANATCTTTAAGTCCTTTGTTAGGTTTGA
AGGACGCTGANTN
Sequence Type genomic DNA
Unitrap ID UNI5500

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 30904932..30905181 238
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048874 (Phf3) NM_001081080 PHD finger protein 3 Gene [Source:MGI Symbol;Acc:MGI:2446126]


Sequence tag IST14621B10HMF1
Sequence
CTGCACACCGTGGTACTCACACCCACGTCACACACACTCACAACCACAAGGATAACAAACAATTGTAAAATTTAAAACAA
GAGCATCATAGACTAGGTGCTACTCTATTCAAAAATGCCCTTCGCCCACACTCACAGACACAAGTTCCACATTCTTTTGC
TGTTTTTCACTGGAGAGAAGTTTTATTTGGAAAACGAGTTGTTTGTTTTTTAAATTGTGAAACCCATGCTGACCTCTAGG
TTCCAGCAATCCTCCTGCCTCAGCCAGAGTACAAGCACCAAGTTCANTGCCTATAAATTTTTTATCNTNNTTATATTNAC
TTCATGTCNANGTGTGNCNNGCNNNTNNNGGTCAAGGACCACTGATGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000048874


For any suggestions or comments, please send an email to unitrap@crg.es