Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12101E3
Clone ID IST12101E3
Vector VICTR76
Project tigm

Sequence tag IST12101E3HMF1
Sequence
CTTGGAGCCGGTAACAGGAGAGACCTGAATCTCCCAGACAGGAAAGGTTAAGCACAGAGTGTGGGGCGGCTTCCTGGTCT
AGGCCCCGCCCANNNNCNNCCCGGANAGCCGGAAGTCGGAGAGCCGAGCTTACAGTGGTGGACGCTAGGACCTGGGAGTG
CGGGTCACCGGGGGGCGGGGACGCTCACGTGANGACNCCGCCTTGGGGTAAGTGTGCANGGTGGGCGAGGGGCNGACTGG
GAGCNCANNNCNGGGNNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12101E3BBF1
Sequence
CTTGGAGCCGGTAACAGGAGAGACCTGAATCTCCCAGACAGGAAAGGTTAAGCACAGAGTGTGGGGCGGCTTCCTGGTCT
AGGCCCCGCCCACCAGCAGCCCGGAGAGCCGGAAGTCGGAGAGCCGAGCTTACAGTGGTGGACGCTAGGACCTGGGAGTG
CGGGTCACCGGGGGGCGGGGACGCTCACGTGAGGACGCCGCCTTGGGGTAAGTGTGCAGGGTGGGCGAGGGGCGGACTGG
GAGCGCANGACCGGGAGGAGGCCGCGACCCTGCCGCCCACCGGCTGGAGGCGAGTGAGGGCTCCCGGGCGGGACGGGCCC
GGACGGACCGGGAAGGCGATGTAGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI36586

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 66460783..66461131 347
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024101 (ORF19) NM_001037757 open reading frame 19 Gene [Source:MGI Symbol;Acc:MGI:1916017]

 
Come back to gene ENSMUSG00000024101


For any suggestions or comments, please send an email to unitrap@crg.es