Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12156C1
Clone ID IST12156C1
Vector VICTR76
Project tigm

Sequence tag IST12156C1HMR1
Sequence
ATACTTGTTGCTAATTATAGCATTCTGCCTTCTATGTAACAAATTAGAATACCCGGAAAAGAGGAGACAGTCAATGATAA
CACGAATGCAAATAAATTCTTTTTCTTATGGTAGAGTAACTTCAATGTCAATACTTANAANATCCACATATATCAAGGAA
AATATTTTCTAAATGAAAACCTTGTGTGCTTGCTGTCATAAAACATAATGAAAAGCANCTTGGGGAGGAACGGGTTCATT
TGGCTTATAGGTTATAGTCNNTCACTGATGGAAGCCAGGGCAGGAACTTGGAGGCAGGAACTGTATGTANCANANACCTT
NNAGAATACCGCTTGTTC
Sequence Type genomic DNA
Unitrap ID UNI32953

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30967047..30967384 314
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]

 
Come back to gene ENSMUSG00000075415


For any suggestions or comments, please send an email to unitrap@crg.es