Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14600H11
Clone ID IST14600H11
Vector VICTR74
Project tigm

Sequence tag IST14600H11HMF1
Sequence
GTACATCCTACAAACCAGGGGGCTGAGCATCTTGTCCCATTCACACAGCAACGAGAGTGGAGAGGGGTTCCATGATAGAC
TCATGGTTCTAGATCCTGGTTTTTAATGACTTCAGCAAGAACCAGGATTTACAGGAACCTTATAAACACCAGGAAAAGAG
GATGTCATTAAGCTTTTTCCAATTTTCCCCAACAAAGTGACCAGCCAGTTACTAAACAGTCTTCAATAGAATTCATTGAA
TCAAATTCCCATGATGTTTGGACTNTGGGTAAGAAGATGAGCAGATGCCCTGGGCTCTCAGTTTCTTCGTCTGTAATTGT
CC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 100608287..100608607 319
NO GENE  


Sequence tag IST14600H11BBF2
Sequence
AACCTATGTCTCTTTTGCCGAGCGAGCTATTGGCTN
Sequence Type genomic DNA
Unitrap ID UNI36685

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 133583094..133583128 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030727 (Rabep2) NP_085043 rabaptin, RAB GTPase binding effector protein 2 Gene [Source:MGI (curated);Acc:Rabep2-001]

 
Come back to gene ENSMUSG00000030727


For any suggestions or comments, please send an email to unitrap@crg.es