Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12847C8
Clone ID IST12847C8
Vector VICTR76
Project tigm

Sequence tag IST12847C8HMF1
Sequence
NCTGTAATTTCCAACTCCAATAAGCCCATATAAAAACACACAACCCAGTTATTATGGTTATAAGCCATATGCCTCGATTG
GGCAGACCTAGCACTGAATGTACTTAGTCCCCAGCTAAGACCCCTTGCTGCTTGTGACTTACTTCTCCAGGCCACACACA
GGTTAAAATGGGGAGAAGGTTCATTCATTCGCGATCGCCCAGGAGGCGACTCCTCTTGAGGAGGCAGAATTAACATCNGA
ATACAAACNGCATCNGGACAGCCCACCACACTACACACTAAAAAGATGCAGAAAGCTATCAAAAACTAGANAATCATTGC
TNACAAAGTAATTNNAAAGAGTACAACGGANAAGCTAAACATTAAACTCACCGNTTTCTTCCNTCTGCTGNANTATGGGA
NCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 58435110..58435510 369
 
EST/CDNA Est Name
  BG086132.2 - CF900774.1 - BY593819.1 - BB762783.1 - BB602495.2 - CF951704.1 - DV657406.1


Sequence tag IST12847C8HMR1
Sequence
NNCNNCAACANNTAGTACTCGTTTTATTTGCTGCCNTTCCATTTAGGTTTAGCTTGACTTCATAGAAGACAGATTTTTTT
AAAAAAGATTTATTTATTTTCATGCATATGAGTACACCGTATCTGTACAGATGGTTGTTAGCCTTCATGTGGTTGTTGGG
GATTGTACTTAGGACCTCTGTCGCTCAGTTTGACCTGCTTGCTCCGGCTCAAAGATTCATTATTATACATAAGTACACTG
TANTTGTCTTCNNACGCACTANGANAGGATGTCANATCTNNTTATGGGTGGTTGC
Sequence Type genomic DNA
Unitrap ID UNI14936

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 58434821..58435109 267
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021965 (F630043A04Rik) NM_198605 RIKEN cDNA F630043A04 gene Gene [Source:MGI Symbol;Acc:MGI:3041235]

 
Come back to gene ENSMUSG00000021965


For any suggestions or comments, please send an email to unitrap@crg.es