Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST430517
Clone ID OST430517
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST430517
Sequence
TGAGTTGATATGAACACAGATCAAGNATTAGAGAAATCTTTGCAAAAAGAAAGGCTTGAACACAAGAAAGCAAAGGAAGA
TTTCCTTGTTTATAAGTTAGAAGCACAAGAAACACTTAACAAAGGAAGGGTAAGGCTTTGTTCTGTTTTGGCTTTTATTT
TGTTCTCATGAACTTTAAGGGAGATAAAAATACCACTGCAAAAAATTTTACTCCATTTATTACCAGCATAAATGGATTAA
GGGTGGACATACATTTTTGTTACCAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI18092

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 75713786..75715573 197
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034109 (Golim4) NM_175193 golgi integral membrane protein 4 Gene [Source:MGI (curated);Acc:Golim4-002]

 
Come back to gene ENSMUSG00000034109


For any suggestions or comments, please send an email to unitrap@crg.es