Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14680A9
Clone ID IST14680A9
Vector VICTR74
Project tigm

Sequence tag IST14680A9HMF1
Sequence
TTTCTTCTACCCCTCGTGCTTATACGTATATTAAAGTATCGCTTTAGGGGAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 72258020..72258081 62
NO GENE  


Sequence tag IST14680A9BBF1
Sequence
TTTCTTCTACCCCTCGTGCTTATACGTATATTAAAGTATCGCTTTAGGGGAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 72258020..72258081 62
NO GENE  


Sequence tag IST14680A9HMR1
Sequence
NAAAAAGGCACTCAGAAATNANACATACCCAAGCGTGGTTGCCGGCTCCTANAGAGAGAANAGATAGGACTGTGATTTTT
ATTTTTCCTTAAAATGTTGGTTTTTTGTTTTTTGTTTTTTTCTTCCTCCCTATCGTGAGTTTGCTGAAATTAAGTTCCAC
CATGCCNGGTTC
Sequence Type genomic DNA
Unitrap ID UNI8511

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 72257853..72258022 160
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039395 (Mreg) NM_001005423 melanoregulin Gene [Source:MGI Symbol;Acc:MGI:2151839]

 
Come back to gene ENSMUSG00000039395


For any suggestions or comments, please send an email to unitrap@crg.es