Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10897H4
Clone ID IST10897H4
Vector VICTR76
Project tigm

Sequence tag IST10897H4HMR1
Sequence
CCNCGAAGAGGATTGGCTGCTCGGTTCCTCNNCCTCTTCCTGGGCCGCTCATTTCCTCTGGGTTCACCATTTTCCAACTC
ACCTCACCCCAAATGACCCTGCCACTGATCCCCCTGAAGGCAGGGCCTGGGCCGCCCTGTTCCTTCAGGCCCCAGAGCCT
CTGCGGCCTAATTACCAGCCAGGAGGAGCCTGCATCCCCACCCANCTGGAGGCCNNCTGCAGGAGAGAGGAGGATTGANA
CNTTTCCCTTTCTTCTGAGGCCTTGTTANTTCTTCCTGCTGGTGATTANCCNNTTATTTTTAGCTCCANCTAAGCACCCT
GGTTANTNTTCAAGGCTGCTTTNNACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10897H4HMF1
Sequence
NTGGTTAACGCCATCAAAAATAATTCNCGTCTGGCCTTCCTGTANCCNGCTTTCATAAAAGGTGTGAGAGATCTATTTTT
TAAGATATCTGAGGATGCAGGCTTCCATGGGTCANTTGCATTATTGTGAAGAGCTTAAATATTGTTAATGGA
Sequence Type genomic DNA
Unitrap ID UNI36691

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 87484871..87484967 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034177 (Rnf43) NM_172448 ring finger protein 43 Gene [Source:MGI (curated);Acc:Rnf43-004]

 
Come back to gene ENSMUSG00000034177


For any suggestions or comments, please send an email to unitrap@crg.es