Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11066E6
Clone ID IST11066E6
Vector VICTR76
Project tigm

Sequence tag IST11066E6BBF1
Sequence
GTCCTCAAGTGAGGTTTCTGCAGATTCTTTTTGCTTAAAATTTTTTTTCAAGACATAGTTTCTCTGTGTAGCCCTGGCTG
TCCTGGAACTCCCTCTGCTGGCTTTGAACTCACAGATCCTCCTGCCTCTTTCTCCTGCGTGCTGGGATTGAAGACATGTG
CCACCACAGCTAAGTGGTCTGTATAGCTTTAAAGTAGGGTAAGAGTAGTGGCAGTGCTCANCACATGCCTGGCACCATGC
AGTCACAGTATCAGTATGGCACTGATGGGGAAAGCCAAGGGCAAAGAGGTCAGGTAACTGGCGGCTCACTCACACNNCTA
GTGGATGGTGAAAAGGAAAGGCCAGGACTTTAGGCAGGCACAGAGGTGGCTTGGCATCTCTGACCTCTGCCTCTGTGACT
CTTCTGGAAACTTCTGGACTATTCTACAAACACTTGTGTAAATTCTGGGAGGGCTGANCCAGGTTGATCGCTGANGCTCA
TCCAGTACAAAATGTGTAACAGANAAATGTCAGTGAGCACTANGAAGGGCTCTGACNCTGTNNGGCNNGTGAGNCCCTCA
CACTTTCCCTGNATTCCTAGCN
Sequence Type genomic DNA
Unitrap ID UNI31828

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88369925..88370504 549
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000008604 (Ubqln4) NM_033526 ubiquilin 4 Gene [Source:MGI Symbol;Acc:MGI:2150152]


Sequence tag IST11066E6HMF1
Sequence
GTCCTCAAGTGAGGTTTCTGCAGATTCTTTTTGCTTAAAATTTTTTTTCAAGACATAGTTTCTCTGTGTAGCCCTGGCTG
TCCTGGAACTCCCTCTGCTGGCTTTGAACTCACAGATCCTCCTGCCTCTTTCTCCTGCGTGCTGGGATTGAAGACATGTG
CCACCACAGCTAAGTGGTCTGTATAGCTTTAAAGTAGGGTAAGAGTAGTGGCAGTGCTCAGCACATGCCTGGCACCATGC
ANTCACAGTATCANTATGGCACTGATGGGGAAAGCCAAGGGCAAAGAGGTCAGGTAACTGGCGGCTCACTCACACAGCTA
GTGGATGGTGAAAAGGAAAGGCCAGGACTTTANGCAGGCACAGANGTGGCTTGGCATCTCTGACCTCTGCCTCTGTGACT
CTTCTGGN

Sequence Type genomic DNA
Unitrap ID UNI31828

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88369925..88370331 399
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000008604 (Ubqln4) NM_033526 ubiquilin 4 Gene [Source:MGI Symbol;Acc:MGI:2150152]

 
Come back to gene ENSMUSG00000008604


For any suggestions or comments, please send an email to unitrap@crg.es