Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14581C9
Clone ID IST14581C9
Vector VICTR74
Project tigm

Sequence tag IST14581C9HMR1
Sequence
GTTGAAGTTGCTGCTGTGGGGCCTCATTAAGAATTCTCGGGGCCTTAGAGAGGGTGGGAGCAGCTCATTCAAGCTTACTT
AACTTCTGACTGCCTTGGGCATAGGCCAGCTACTAAAATATGAAAAATGTTTGCCCAGCAGCCTCCAGAGCGT
Sequence Type genomic DNA
Unitrap ID UNI1307

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 46749933..46750085 153
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023972 (Ptk7) NM_175168 PTK7 protein tyrosine kinase 7 Gene [Source:MGI Symbol;Acc:MGI:1918711]

 
Come back to gene ENSMUSG00000023972


For any suggestions or comments, please send an email to unitrap@crg.es