Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14180C8
Clone ID IST14180C8
Vector VICTR74
Project tigm

Sequence tag IST14180C8HMR1
Sequence
NNTNACATTTGGCTTGTAGGTCACCTGACTTTGCAAGCCCTTGGGGTTATGCCTTTCTCTGCCTCCCCATTGCTGAGATG
ACAAATGTGGGCCACACACTTAAAACCTTAAATACACACGCACACACAGCAACGAACGTGTGTTCTGGGGATAGAATTCA
TGTTCTCATGCTTGTAATGGCAGGCATCTTATCAACTGANCTAGCTCCCCANCCCTCTTCANTGTTCCCTTGTGTGAGTG
GTCATGGCACGTATGTTGTTGTCCATGTGAAGCTGTATGCACATTTTAAATGAATGGGGCTCTTANCTGCTTCCATATTT
TGGCNAATANTTCCNGCAAGANTTACACCAATCTTGTATTTATAANAGCTACTTCNGGGANGCNNTCCTGGCN
Sequence Type genomic DNA
Unitrap ID UNI25364

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 63531376..63531763 362
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021461 (Fancc) NM_007985 Fanconi anemia, complementation group C Gene [Source:MGI Symbol;Acc:MGI:95480]

 
Come back to gene ENSMUSG00000021461


For any suggestions or comments, please send an email to unitrap@crg.es