Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST430406
Clone ID OST430406
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST430406
Sequence
TTGTTCGGACACTTGACAGGNNGTTTTTCGGGTTCNACCTCTTGGTATGAAGAGTCTGAAACTAGTCATCCANTCAACAG
GAGGTGGNGAGAGCTATCTCCCGGTTTCCCATACCTGTTTTAATCTTCTAGATCTCCCAAAATATACAGAGAAAGAAACC
CTCCGATGTAAACTGATCCAAGCTATTGATCACAATGAAGGCTTCAGTTTAATATGACCTTGGACTTTTNTNTTTNGTAC
AAAAACCACTCGTGTTTCTCTTGTGAATTCAGCACAGTGAGAGTTACTTCTGTAATTCTTACTTATAAATTGTTCACTAC
TGTACTGATGAAAGCCCAAAATTAAAAACTGTGCATTAATACTAAACTGTACAGAACCATGAATTGTCCATCCTCATACA
AGTANTGTGAATACATTAAAGTT
Sequence Type mRNA
Unitrap ID UNI18097

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62780033..62780442 377
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020064 (Herc4) NM_026101 hect domain and RLD 4 Gene [Source:MGI Symbol;Acc:MGI:1914595]

 
Come back to gene ENSMUSG00000020064


For any suggestions or comments, please send an email to unitrap@crg.es