Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14332D6
Clone ID IST14332D6
Vector VICTR74
Project tigm

Sequence tag IST14332D6HMR1
Sequence
ACNNACAATGAAGTATCATTGTCATTTATNAGACTGGGGAAAGGTCTGGGCACTGGAGCAGAGAGCTGCTTGCCGGCAGG
CAGCTGCTGGCACAGGGCCGGATTTTTTTTANAACAGTTTGGTAACACTTCAAACTACCTACACCTTTGACCCANCTATT
TCCCTTCTANATAATTGTCNNACCNTGGCTCCCACAAGGATAGGGACACACATTGCANCACCACATCTAATATGGACNAT
GACNCACATGANACCCTGANACANGATGANCATGGTCNCNCTGTGGATGACCCCAAAGATCTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14332D6BBF1
Sequence
GGTCTTAATTTACAGGTTGGTTTTTTTGGGAGGAGGATGGGGTTTTTGTTTTGTTTTGCTN
Sequence Type genomic DNA
Unitrap ID UNI12986

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 120713366..120713425 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048445 (Ccdc57) NM_027745 coiled-coil domain containing 57 Gene [Source:MGI (curated);Acc:Ccdc57-001]

 
Come back to gene ENSMUSG00000048445


For any suggestions or comments, please send an email to unitrap@crg.es