Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13767G7
Clone ID IST13767G7
Vector VICTR74
Project tigm

Sequence tag IST13767G7BBF1
Sequence
CGGCTTGGGGGGTACACTTCCTGCCCTTCCTACTTGCCTCTATCTGCTTTCCTGTGCCCTACCCCATTTCTACTGCCTCC
CTTCTCTTTTGCTCTTCTCAAGAGCTCCCCAATATTCCTCCAAAGTCAGATGGTGACCCCTCTGGACCTCCTGTTGGCCA
GGTACCTCAAAAGGAATGCACTCCCTANCCCTCCCCTTTGCTGGGGGAAAAAGAGGCTACCTCCAGTTCTTGTCCCCACC
CCACCCCATACCTCTTTTCTTGCCNCCCTGGCCCTTGCCNNGCCCCCACATTTTCATGTGATCANCTCTGANGCCNNAAN
CTAAAACTCTATTTACACACCTCCNNACTCNAAGAAAGAGGAANCACTCNNGANNGNATGGANAGNTGGACANAACTGAT
GCCTGTGGGAANCNCGGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13767G7HMF1
Sequence
CGGCTTGGGGGGTACACTTCCTGCCCTTCCTACTTGCCTCTATCTGCTTTCCTGTGCCCTACCCCATTTCTACTGCCTCC
CTTCTCTTTTGCTCTTCTCAAGAGCTCCCCAATATTCCTCCAAAGTCAGATGGTGACCCCTCTGGACCTCCTGTTGGCCA
GC
Sequence Type genomic DNA
Unitrap ID UNI14695

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 25939995..25940155 161
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074274 (D930028M14Rik) RIKEN cDNA D930028M14 gene Gene [Source:MGI Symbol;Acc:MGI:3687343]

 
Come back to gene ENSMUSG00000074274


For any suggestions or comments, please send an email to unitrap@crg.es