Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14457D12
Clone ID IST14457D12
Vector VICTR74
Project tigm

Sequence tag IST14457D12HMF1
Sequence
GGAGTTCGAAGAAGAAAGGAGTCGCGGGCGGCGCGGCTGGGTGTGCCGGANAAACTCGCACGTCANCCTCGCGAGCTCCC
CTTCCACTCCCCCTGCGCGCACTCCCGCGCGCTGGCCANCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148274478..148274595 114
NO GENE  


Sequence tag IST14457D12BBF1
Sequence
GGAGTTCGAAGAAGAAAGGAGTCGCGGGCGGCGCGGCTGGGTGTGCCGGANAAACTCGCACGTCAGCCTCGCGAGCTCCC
CTTCCACTCCCCCTGCGCGCACTCCCGCGCGCTGGCCACCGCACTCCCGCAGACCGCACGGTCTCAAGTTTCCACCGCTT
CGCTTTGCTCTTGACCTAAAAATGGCCCCGGAGTCCCTCCANATCAGGTCACACNTGTTANANTCNCNNNGCCNTTCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14457D12HMR1
Sequence
CTCCNATAGCCNCAACANNAATGAGGGAAGTGGGGTGAGCAAGGGAAACACAACCCCTTCCACACCCGCCCCACCCGCAG
CCCAAGGGCACCTCGGAAGGGAACGGCAGGAGCGCGCGCGCGCGCGCGTGCCGCANAAAGTCTCGCACCTGCGCTCGCTC
CCN
Sequence Type genomic DNA
Unitrap ID UNI31806

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148274592..148274752 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028977 (Casz1) NM_027195 castor homolog 1, zinc finger (Drosophila) Gene [Source:MGI (curated);Acc:Casz1-004]

 
Come back to gene ENSMUSG00000028977


For any suggestions or comments, please send an email to unitrap@crg.es