Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14452F6
Clone ID IST14452F6
Vector VICTR74
Project tigm

Sequence tag IST14452F6BBF1
Sequence
CCTGGAACTCACTTTGCAGACCAGGCTGGCCACAAACTCAGAAATCCTCCCATCCCTGCCTTCCTAGGGCTGGGATTAAA
GGCTTGAGCCACCACTCCCCGGTATTTTTTAATTTTTTAATTGTATTTATTAAATTCATTTTTGTTTGTTTTTTTTTCAT
GATGCANTTTCTCTGTGTAACACTGGCTGTCCTGGAACTCACTCTGTAGGCCAGGCTGGCCTTGAACCCTAATCTGTCTG
TTTCTGCTTCCCAAGTGCTGGGATTAAATGCATGTGCCACCACTGCCCGGACTAATTTTATTTGTTTGAAAATACCTTTC
TTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCNTTCNTTCTTTCTTTCTTTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14452F6HMF2
Sequence
CCTGGAACTNACTTTGCAGACCAGGCTGGCCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14452F6HMR1
Sequence
GACAGCCAGGGCTATACAGAGAAACCCTGTCTCA
Sequence Type genomic DNA
Unitrap ID UNI20609 UNI31432 UNI33346

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4750350..4750383 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 4556470..4556503 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3054501..3054534 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3313865..3313898 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3046748..3046781 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 4092036..4092069 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 4059546..4059579 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 3109273..3109306 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3140494..3140527 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3015191..3015224 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3342138..3342171 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024900 (Cpt1a) NM_013495 carnitine palmitoyltransferase 1a, liver Gene [Source:MGI Symbol;Acc:MGI:1098296]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 3343371..3343404 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 3826488..3826521 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 3573486..3573519 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3085718..3085751 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 4589753..4589786 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015189 (Casd1) NM_145398 CAS1 domain containing 1 Gene [Source:MGI (curated);Acc:Casd1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3282456..3282489 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 4154849..4154882 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 3349956..3349989 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025899 (Alkbh8) NM_026303 alkB, alkylation repair homolog 8 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:1914917]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_053651: 11006..11039 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_110857: 134929..134962 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165789: 318190..318223 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166310: 50571..50604 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166323: 115397..115430 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166328: 70796..70829 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166434: 199162..199195 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166441: 234000..234033 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166447: 15419..15452 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 3158600..3158633 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 427210..427243 34
NO GENE  

 
Come back to gene ENSMUSG00000025899


For any suggestions or comments, please send an email to unitrap@crg.es