Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13329G8
Clone ID IST13329G8
Vector VICTR74
Project tigm

Sequence tag IST13329G8HMF1
Sequence
CTCAAAGGTACTAGAAAACCAAACAAACCAAACCTGAAAGGGCTAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 22300219..22300268 50
NO GENE  


Sequence tag IST13329G8BBF1
Sequence
AGGGGCTTGCCGCTTTTGTCTTTTCTCTTTGTCCANAGAACCTTATGTAANAACTCTTCTTGGGAAACAGGAAGTCCAGC
TTGCCAAGTTCAGCACAGGGAGTAGTGCAGGCCTGGTTCCAACACACCCGGCCCAGCCTTAACCCCAGCACCCTGCCAGT
TTCTTGTCCCTGGTTCTCCTCCCTGCTGGCCCCTAAACCCCTTTTTTTCATCTCCAGTCACCCCTAACAAACCTCCTCAA
AGATCTG
Sequence Type genomic DNA
Unitrap ID UNI30001

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69499200..69499445 242
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018752 (Tnfsf12) NM_001034097 tumor necrosis factor (ligand) superfamily, member 12 Gene [Source:MGI (curated);Acc:Tnfsf12-002]

 
Come back to gene ENSMUSG00000018752


For any suggestions or comments, please send an email to unitrap@crg.es