Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13079G4
Clone ID IST13079G4
Vector VICTR76
Project tigm

Sequence tag IST13079G4HMF2
Sequence
AAAATTGCCAGTGTTCCATTGACTGCAGCTTGCAGTTTGATTACAAATTTAAGATCTTCTACTCACCCATATATTGTTAA
TTAAGATTATTACAAGAGTAATCATCTTTTAAAAGCGCTAATACAGCTCCCTTCATACAAAACTGTGACAAAGTTATCTA
GTTATGTTTGTCTTTGTGAATAGATTAGACAAACAGTTTGGCTATAGTTGCTGCCTGGCAGGAAACTGCAGTACGGGCAA
TTTTTTCACAACACTAAAGTTGTGAAGAACGTTTTAACTGTAAGTCATCTTAAGATAGAGTATCAAAAATTAGAGGCGTA
GACAGTTATATTGTTCCTCTAGAATCGGTCCTTATTACAGGAGGGCCAAGANGCTCAGANTAAAAAGTATTTTACGTTTG
ANTAAATACAGGGCTCTGGGCAGCCCCAGANCGGCTTGTGGCCGTCTTACNTTTTGCAAACNGTGCCTGAAAAAGTTTTT
CCCTGTGTTCNAGAAAATTTCTTTTTAACAGTGTTGCAANTCTATTCNNANGTTTAATNANGCTTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 83049078..83049623 520
NO GENE  


Sequence tag IST13079G4BBF1
Sequence
AAAATTGCCAGTGTTCCATTGACTGCAGCTTGCAGTTTGATTACAAATTTAAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI32669

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 27077864..27077920 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 66478221..66478277 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074834 (Vmn2r-ps105) vomeronasal 2, receptor, pseudogene 105 Pseudogene [Source:MGI Symbol;Acc:MGI:3040709]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 28499805..28499861 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 9152188..9152244 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3475312..3475368 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 13215735..13215791 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 12932485..12932541 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 8048249..8048305 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 7431672..7431728 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 5271675..5271731 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 51382490..51382546 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 39354262..39354318 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161872: 252821..252877 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161913: 235188..235244 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166391: 426430..426486 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 112108089..112108145 57
NO GENE  

 
Come back to gene ENSMUSG00000074834


For any suggestions or comments, please send an email to unitrap@crg.es