Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11803D8
Clone ID IST11803D8
Vector VICTR76
Project tigm

Sequence tag IST11803D8HMF1
Sequence
AACCTTGTTCCCGTTTCAGTGTTCTAGCTATCCTATCTGCAGAGGGCGCCTTGATGTGTCCCTNTNTNACCTTTCTCATT
TCACTGATAATACCAACTCCGCCTTCCTG
Sequence Type genomic DNA
Unitrap ID UNI30917

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 35970069..35970176 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022906 (Parp9) NM_030253 poly (ADP-ribose) polymerase family, member 9 Gene [Source:MGI (curated);Acc:Parp9-001]


Sequence tag IST11803D8BBF1
Sequence
AACCTTGTTCCCGTTTCAGTGTTCTANCTATCCTATNTGCNGAGGGCGCCTTGATGTGTCCCTTTCTTACCTTTCTCATT
TCACTGATAATACCAACTCCTCCTTCCTTAGTTAGAAGCTAACATTTACCTTAAAGTAACTTAGTTACTTAANAAAGTAA
CTTGAAGAAACTTGTATCTTGTGCCCCGCCCTACCTTTTTTAGACAGAATCTATGTANTCCCGGCTGTCTTGTAACTCAC
AGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI30917

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 35970069..35970317 239
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022906 (Parp9) NM_030253 poly (ADP-ribose) polymerase family, member 9 Gene [Source:MGI (curated);Acc:Parp9-001]

 
Come back to gene ENSMUSG00000022906


For any suggestions or comments, please send an email to unitrap@crg.es