Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11959A11
Clone ID IST11959A11
Vector VICTR76
Project tigm

Sequence tag IST11959A11BBF1
Sequence
ACCTGACTGCTCTCCGAAGGTCTGAAGTTCAAATCCCANCAACCACATGGTGGCTCACAACCATGTGTAACAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI1859 UNI31247 UNI32020

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 98514452..98514530 75
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017211 (Gsdma2) NM_029727 gasdermin A2 Gene [Source:MGI (curated);Acc:Gsdma2-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 121262324..121262402 75
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027248 (Pdia3) NM_007952 protein disulfide isomerase associated 3 Gene [Source:MGI (curated);Acc:Pdia3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 134854768..134854846 75
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 135843494..135843572 75
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048170 (1110007A13Rik) NM_145955 RIKEN cDNA 1110007A13 gene Gene [Source:MGI Symbol;Acc:MGI:1920977]

 
Come back to gene ENSMUSG00000048170


For any suggestions or comments, please send an email to unitrap@crg.es