Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14766D6
Clone ID IST14766D6
Vector VICTR76
Project tigm

Sequence tag IST14766D6BBF1
Sequence
TTCTTAGTTCCTAGAATGTAATCGCAGATCAAATAGCCATGATTCATGAGCCAGCACAAAGGGCCCTTTGCTTCCCAGCA
GACCCCAAGAAGGGCAGAACAATGGCCCTAAGAGCCTCATCAGGAGCCTTGTTCTGGTTACCTTTCTCCTTCCTGGATAT
CAATAGCCTTGGAAAGTGCTTTCTACAGCATGTCCAGTGCTGTGTCTAAAAATAGCCTTGCTTATACACACACACACACA
CACACACACACACACN
Sequence Type genomic DNA
Unitrap ID UNI10947

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6240416..6240669 254
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040675 (Mthfd1l) NM_172308 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like Gene [Source:MGI (curated);Acc:Mthfd1l-003]


Sequence tag IST14766D6HMR1
Sequence
NNANTGCCTCAGAAAATCACTCACAGTCNTCCCACTGCCTCANAAAATCACTCACAGACATCGCCCTGCCTCANAAAATC
ACT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000040675


For any suggestions or comments, please send an email to unitrap@crg.es