Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14742F2
Clone ID IST14742F2
Vector VICTR76
Project tigm

Sequence tag IST14742F2HMR1
Sequence
NATAAACTTCCCAGGGCGAGTCTAGCACTCCCATTACCGTCTCACAAGTCGTGTCTGCCCGCCCACCCTGCCCCCAGCAA
AACAGCACCGGGGCTGGGAGTGGGGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35187533..35187638 106
NO GENE  


Sequence tag IST14742F2HMF1
Sequence
ATAGAAGAGGTTTCCAGCAGCCTAAAGGGGAGAAAGGTAAAGTTTCAGGAATGAGAGAGTGAATGGGGTTCGGTGCGGGA
TCCAGGGGGATCCAGACAAGAGAAGGACCGAGAAAGGGACAGTGGTGGGGTTCGAGAAGGTCNNGANAGTTGGCTNCNAC
GTGTGGCCCTATGAAAGANAGANAAAAATGAANNATGGNGCNNANANAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14742F2BBF1
Sequence
ATAGAAGAGGTTTCCAGCAGCCTAAAGGGGAGAAAGGTAAAGTTTCAGGAATGAGAGAGTGAATGGGGTTCGGTGCGGGA
TCT
Sequence Type genomic DNA
Unitrap ID UNI20638

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35187637..35187718 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007041 (Clic1) NM_033444 chloride intracellular channel 1 Gene [Source:MGI Symbol;Acc:MGI:2148924]

 
Come back to gene ENSMUSG00000007041


For any suggestions or comments, please send an email to unitrap@crg.es