Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14778G3
Clone ID IST14778G3
Vector VICTR76
Project tigm

Sequence tag IST14778G3HMF1
Sequence
CGACCTCCAAACTCAGGGGTCGTAGCATTGCTCTTGAGTGGGTTTTATAAAGACCAACCCTACAGGTGTGCCCACCCACC
CACACCCCACACATACTTCACCTTCTGGAAGTCTCTTTAATTTTCTGTTGGCTGTCATCCTGTATTCCTTTCTTGCCCCA
AAGCATGAGGGGTCCTTGGGTGGTGGGCCCTGCCCTCTAAGGGATCTTTACAAATAGGGAGCCGACCTCACAGGGCTTCG
CCTCCTCCATGGCAGCTGCTCTAATGCATATANCTAATGTTCNGNAATACTGGGTTGGGGAGTTAANTAACTCNNGNNNT
CNGANCAGA
Sequence Type genomic DNA
Unitrap ID UNI31684

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165640292..165640619 306
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]


Sequence tag IST14778G3BBF1
Sequence
CGACCTCCAAACTCAGGGGTCGTANCATTGCTCTTGAGTGGGTTTTATAAAGACCAACCCTACAGGTGTGCCCACCCACC
CACACCCCACACATACTTCACCTTCTGGAAGTCTCTTTAATTTTCTGTTGGCTGTCATCCTGTATTCCTTTCTTGCCCCA
AAGCATGAGGGGTCCTTGGGTGGTGGGCCCTGCCCTCTAAGGGATCTTTACAAATAGGGANCCNACCTCACANGGCTTCN
CCTCCTCCNTGGCAGCTGCTCTAATGCNTATANCTNANGTTCTGGANTACTGNGTTGGGGANTTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000039671


For any suggestions or comments, please send an email to unitrap@crg.es