Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14316C11
Clone ID IST14316C11
Vector VICTR74
Project tigm

Sequence tag IST14316C11HMR1
Sequence
ATANNTTGAGGCNCANANAGTTCTGGGCCNTCTCANCCTCGGGGTGACGGCTGGTAANGTGGCGCANGGNNCANACNNCN
GGCTNNGTNATGTCATCTTTGTCNNCNGCTCTCAAGATGGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14316C11BBF1
Sequence
CTATGGAATCCCGGCCATTGTGAAACTGCTCAACCAGCCAAACCAGTGGCCACTGGTCAAGGTACCCAGTAAAGGCCACA
GGCACTGGGGTAGGGGTAGGTGAGGGGTCTGTCCATGTTCAGGGTCATAGGGATATATGGTAAGGATCT
Sequence Type genomic DNA
Unitrap ID UNI12938

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100239316..100239463 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001552 (Jup) NM_010593 junction plakoglobin Gene [Source:MGI (curated);Acc:Jup-001]


Sequence tag IST14316C11HMF1
Sequence
CTATGGAATCCCGGCCATTGTGAAACTGCTCAACCAGCCAAACCAGTGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI33428

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100239412..100239463 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001552 (Jup) NM_010593 junction plakoglobin Gene [Source:MGI (curated);Acc:Jup-001]

 
Come back to gene ENSMUSG00000001552


For any suggestions or comments, please send an email to unitrap@crg.es