Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13076C9
Clone ID IST13076C9
Vector VICTR76
Project tigm

Sequence tag IST13076C9HMF1
Sequence
GGTNANTGGGGTCGATCCTCAGGGTTGCANNNNNCAAACACTATCTTGTGTAGCTTTGATTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13076C9HMR1
Sequence
TACCCTTGCAGCTTCGTCTCTGGGCATCCATGGACCCCTGCACCCGAGGATGTTCTCATGACAGCCTTCTTTGGTTTTTC
TCCGTAGCGGTCTATCAACCGGAGTCTTTCATCCTGCACCGCAGCCAGGACATTAGGCCCAGAGCTGTTTTCTACAGGCA
CTTTGGGGGTTCATCCCTTAACACGCAACACTGTAACCCTTCATGCTACAGCTACTATGCTTCATTCATCTTTTCTGACA
AAGGAGAGCCCTCTTAGGACAGCCTCGGGGTAGAAGGAGTAACGGCAGGCGTTACAGAAAGCACGCTAGGGTCCCTCTGG
GAAGCCTGAACTTCCGGGTGGTGCCTCCTTGGGGACNTCTCTAGGAAGTCGGCTCGGTGCTCTGGANGACCGGAGCTGCT
CCATTGGGAANAGCANANTCTGCNCANCAGGAGCTGTCCNAANGGAGGCGGGGCCNANNGAGACCNANNNCGGANCGNGA
GGACCTCACNGNNCAGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13076C9BBF1
Sequence
GGTAAGTGGGGTCGATCCTCAGGGTTGCAGTTTTCAAACACTATCTTGTGTAGCTTTGATTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI33931

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 137429460..137429556 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019054 (Fis1) NM_025562 Friend virus integration site 1 Gene [Source:MGI (curated);Acc:Fis1-002]

 
Come back to gene ENSMUSG00000019054


For any suggestions or comments, please send an email to unitrap@crg.es