Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14652D4
Clone ID IST14652D4
Vector VICTR74
Project tigm

Sequence tag IST14652D4BBF1
Sequence
NACCTGACAGCCTCTGGAACAGGCANAANCACAGAGGGGCTGAGGCAGCACCCTGTGTGGGCCGGGGACANCCGGCNNCC
TTCCGGACCGGNNGANAGGTGCCCNCCCGGCTGGGGAGGCNACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14652D4HMR1
Sequence
NNGGCCTAGCCTTTTGCTTCCTGGGGCTTCAGAGAGCCTGGGCCCCACTGTCTGGGAGGAGGTAGGTGACAGGGTCTTTT
GCCTCTCTTTCTTTACGTAGGTATTTTGGGCTGTACCTCTGGATCTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI30020

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 71026477..71026604 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022099 (Epb4.9) NM_013514 erythrocyte protein band 4.9 Gene [Source:MGI Symbol;Acc:MGI:99670]

 
Come back to gene ENSMUSG00000022099


For any suggestions or comments, please send an email to unitrap@crg.es