Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14346H9
Clone ID IST14346H9
Vector VICTR74
Project tigm

Sequence tag IST14346H9BBF1
Sequence
GGACAAGGGTTTGATGAAGAGTTATTACATCAGAGTAAGTAATATTCTCTATAACT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 88166038..88166093 56
NO GENE  


Sequence tag IST14346H9HMR1
Sequence
TCCTTTTCTGAAGGACACTGGGCTCCACAAATGGTTTACTCCCGACCATTGTGTGCTTTTCCCCANACTGCANGACCAAT
CGGTCCCACCTTTCTTCAGCTTTCTCCCCTTANGCATTGAAAGGCAGGAAGAAATGGAGGGAGGAAN
Sequence Type genomic DNA
Unitrap ID UNI30237

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 88166091..88166238 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005621 (Zfp592) NM_178707 zinc finger protein 592 Gene [Source:MGI (curated);Acc:Zfp592-001]

 
Come back to gene ENSMUSG00000005621


For any suggestions or comments, please send an email to unitrap@crg.es