Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST429927
Clone ID OST429927
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST429927
Sequence
TGAGAATGGGACGCCGGTCTTCAGNCACTGAAGAGGAAAGCAGAAGCAAGAGGAAAAAGAAACACCGGAGGCGCTCGTCT
TCAAGCAGCTCTTCAGACAGCAGGACATACAGCCGCAAGAAGGGCGGGAGGAGGCCGAGGTCCGACTCAAGGTCCTGGTC
TAGAGACCGCCAGCTTCGCTCGCATTCTTATGAGAGAAGACGCAGGCGCAGATCAAGCAGCAGCTCTTCTTATGGCTCCA
GAAGGAAAAGAAGTCGCAGTCGTTCCAGGGGCCGAGGGAAACCCTATAGAGTTCAAAGGTCTCGGTCAAAAAGCAGAACC
AGAAGGTCCAGGTCAAGGCCTCGTCCACGCTCACATAGTAGAAGCAGTGAAAGATCCAGTCACAGAAGAACCCGTAGCAG
GTCCAGGGACAGAGACAGACGTAAAGTCCGGGACAAAGAGAAAAAAA
Sequence Type mRNA
Unitrap ID UNI18113

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 66798440..66886576 193
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034544 (Rsrc1) NM_025822 arginine/serine-rich coiled-coil 1 Gene [Source:MGI Symbol;Acc:MGI:1914130]

 
Come back to gene ENSMUSG00000034544


For any suggestions or comments, please send an email to unitrap@crg.es