Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14557B8
Clone ID IST14557B8
Vector VICTR74
Project tigm

Sequence tag IST14557B8BBF2
Sequence
CTTGCAACTCATACATACCCTGCATGGAAATTATTTACCTTCTTTACCTCACTTCTCTGCTGTTATCCTTATTTTTCCAT
TATTGTCAAAACTTCACAAGTCAGTATTTGCTATGAGAACTTTACTCTCTACTAGCTGTAATCTGGGGTATGCATCAACA
TTCCATTCAACACTGCCCTCACAGTTCCAGCTGGACTGCTTACTGCTAAACCCAAAGAACACTCAAATTTCTCCATCTCA
GCCTTCCAATACTCATTGACTTCTCATTCAGTTTCTTTAAATGCTGGCCTGCGGGCTGGAGAGATGGCTCAGAGGTTAAG
AGCACAACTGCTCTTCCAGAGATCCTGANTTCAATTCCCAGCAACCNCATGGTGGCTCACAACCATCTGTAATGAGATCT
GT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 59717378..59717778 397
 
EST/CDNA Est Name
  BY719389.1 - BG804740.1 - BG805055.1 - BG801038.1 - CN840976.1 - CD770132.1 - BU513769.1 - BI991218.1 - BG077583.2 - CD563295.1 - BE372589.1 - BF163588.1 - DV044887.1 - BE377667.1 - CB182616.1 - CB953663.1 - BQ939016.1 - BG806881.1 - BI988293.1 - BU558706


Sequence tag IST14557B8HMR1
Sequence
AAGTAGAAGAATTAAAGGAAGATGGTGGTTGGGAGAGGGCTCTGGCTCTGANAAGGCATTTCAGTATTAGACTTAAGTTC
Sequence Type genomic DNA
Unitrap ID UNI2214

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 59717302..59717380 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026021 (Sumo1) NM_009460 SMT3 suppressor of mif two 3 homolog 1 (yeast) Gene [Source:MGI (curated);Acc:Sumo1-001]


Sequence tag IST14557B8HMF3
Sequence
GTACCTGGCCCACTCTACTCAGGATTCTAAACGACCCATCCCCAGGACGGAAAAGCCCAAGCCATCCGGGAAGGGAAACA
AGCCATCAGGGCTTGGTCCTGTTATAAAGCAAGCACTCTCGGGAGGACGAATCCCAGCCTGGCCCCTTGTGGGCTCTGCT
GCCTTGCCTTACCCTTGATCCCTAATGCATCTCAGTTTCCTGGCTTATGGACGGGCACAGTGGCCCATGGCCCTGTGCAG
AGAAATAAAGGAGGTGCTGGACTCTTGGCTGGCATCGTGTGAAGTTGCTGGGGGCTCTTACGTTGGCAGTGATGCAGGAG
GCCTGANGTTTTTGGCTGCCTGGANAGCAACATTCCCTGCACTCTCCCTTCCCTGGTTCCCTTGCTAGATTCCCCAGCCT
GGCCGCTATCCCACTGTCCCTTCATGTGTGTGACTGTGGCTAGGAGNAGCCCCTGTGTCCTGTGCTGNCANTGTNNGGNA
CCANANAACTTTGCNNNCCACAGCTGGNNGCANCCNTT
Sequence Type genomic DNA
Unitrap ID UNI30528

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79457862..79458375 479
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017639 (Rab11fip4) NM_175543 RAB11 family interacting protein 4 (class II) Gene [Source:MGI (curated);Acc:Rab11fip4-001]

 
Come back to gene ENSMUSG00000017639


For any suggestions or comments, please send an email to unitrap@crg.es