Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST429905
Clone ID OST429905
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST429905
Sequence
ACTGAGAGACTGAGTCCTCTGATGAGCACTCCTGACCCAGAGCTGAGACCCATCACTCTGTGCACCCCTAGCAACCTGAC
AACCCTCCAGTCTGATGGTCACAGGCAGTAGCTGTGACACCACAGAATGGTCCTCTCTGGGGCGACCGGTTGATTGTTCA
GTACCACCTACTAAACGTGTAGTCATCCTACTGACATGATGGCTTTCCAAACTGTTCCCAAGTGCTGAAAATAGAACTTT
ATAATACTTAAATAAAATAAATTATTGAGCAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI18114

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 75152990..75153258 264
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033590 (Myo5c) NM_001081322 myosin VC Gene [Source:MGI Symbol;Acc:MGI:2442485]

 
Come back to gene ENSMUSG00000033590


For any suggestions or comments, please send an email to unitrap@crg.es