Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10591E2
Clone ID IST10591E2
Vector VICTR76
Project tigm

Sequence tag IST10591E2BBF1
Sequence
AGATAAGGCAGGANAACTCTCTGTGAGTTTGAATTCTAGGCTAGCCAGGGCTACCCTGCCTNAAAAAACCATGGCCNACA
AAAATCCNACCAACCAACCAACCAACCAACCAGACAAAAAAGAATAAAGAAAAAATGTGCTGGAGAGATAGCTCAGTAGT
TATGGGCATTTCTGTTTTCCTAGAGGACCTGCATTCAGTTCTCAGTACCCACATCAAGTGGCTTACAATCACTGCTAACT
CCAGTTCCAGGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI31759

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95482599..95482856 248
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015850 (Adamtsl4) NM_144899 ADAMTS-like 4 Gene [Source:MGI (curated);Acc:Adamtsl4-001]


Sequence tag IST10591E2HMF1
Sequence
AGATAAGGCAGGAGAACTCTCTGTGAGTTTGAATTCTAGGCTAGCCAGGGCTACCCTGCCTCAAAAAACCATGGA

Sequence Type genomic DNA
Unitrap ID UNI31759

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95482783..95482856 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015850 (Adamtsl4) NM_144899 ADAMTS-like 4 Gene [Source:MGI (curated);Acc:Adamtsl4-001]

 
Come back to gene ENSMUSG00000015850


For any suggestions or comments, please send an email to unitrap@crg.es