Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10023B1
Clone ID IST10023B1
Vector VICTR75
Project tigm

Sequence tag IST10023B1BBR1
Sequence
GAGTCTGGTGCCGAGTCAGCTGTCAGCACCAGTGCCAGATCC
Sequence Type genomic DNA
Unitrap ID UNI32880

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 33090591..33090632 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004105 (Angptl2) NM_011923 angiopoietin-like 2 Gene [Source:MGI (curated);Acc:Angptl2-001]


Sequence tag IST10023B1BBF2
Sequence
CATGGAGGCTGTTCCCGTTCGAGTGACAGAGAGAGCTGCTCAGAGGAGGCTGGCTTGTCCCACAGGGCAACAGGTTTGGT
AGTATCAAAGCCCCTAGCCTCTTATTTCAGCTCACTGCTCCTTCCACTGGTATTGATAATTTGAAAACTTAACAGCAACC
ACCTATGACTTGAGGGGCTGGAGAGATGTTGAGCAGTTAAGAGTACTTGCTATACAAGTATGAGCTCCCACATGCCAAGT
TGGGCCTCCTGCACCTCCTGTACATTCAGGATTGAGGAAGGCAGAGACAGGGAGGGCTGCTGGCTGGTAGACTAGCCAAA
AGTGTTTAGGGAGAGACCTGACTCAGTGGGATTACGGTAGAAAGTGGTAGAGGAGGAGATTGAATGCCCTCTTCTGAGCT
CCAGGCATGCAAAACATGCACAGTCACATATCCAAGTACATAAATATACCTAGAAAGACAGCCAGAACAATCCAACCTGA
AGCCTGAGTGCAGGACACTCTACCTCTGTGAAGGTTTTCTGGATTTGTTGTTGTTGTCTGATTGGGTG
Sequence Type genomic DNA
Unitrap ID UNI32282

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20438805..20439352 540
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]


Sequence tag IST10023B1HMF3
Sequence
CATGGAGGCTGTTCCCGTTCGAGTGACAGAGAGAGCTGCTCAGAGGAGGCTGGCTTGTCCCACAGGGCAACAGGTTTGGT
AGTATCAAAGCCCCTAGCCTCTTATTTCAGCTCACTGCTCCTTCCACTGGTATTGATAATTTGAAAACTTAACAGCAACC
ACCTATGACTTGAGGGGCTGGAGAGATGTTGAGCAGTTAAGAGTACTTGCTATACAAGTATGAGCTCCCACATGCCAAGT
TGGGCCTCCTGCACCTCCTGTACATTCAGGATTGAGGAAGGCAGAGACAGGGAGGGCTGCTGGCTGGTAGACTAGCCAAA
AGTGTTTAGGGAGAGACCTGACTCAGTGGGATTACGGTAGAAAGTGGTAGAGGAGGAGATTGAATGCCCTCTTCTGAGCT
CCAGGCATGCAAGACATGCACAGTCACATATCCAAGTACATAAATATACCTAGAAAGACAGCCAGAACAATCCAACCTGA
AGCCTGAATGCAGGAGACTCTACCTCTGTGAAGGTTTTCTGGATTTGTTGTTGTTGTCTGATTGGTTGTTTTTTGTTATG
TTTT
Sequence Type genomic DNA
Unitrap ID UNI32282

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20438805..20439368 564
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es