Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10854E6
Clone ID IST10854E6
Vector VICTR76
Project tigm

Sequence tag IST10854E6HMR1
Sequence
GTAAGGAAATACTGGACNNAAGAAAGACAGAAAATCTGATGTCAAAGCACTGTGTTCAGCTCTCCAACTCTTCGTCTTCG
TTC
Sequence Type genomic DNA
Unitrap ID UNI6799

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28527767..28527848 78
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037640 (Zfp60) NM_009560 zinc finger protein 60 Gene [Source:MGI (curated);Acc:Zfp60-001]


Sequence tag IST10854E6BBF1
Sequence
CTTACAATGCTCCTTTTTGGAACCATANTGTATATATATCCTGTGACATTATATGNNGAAAGTATGTGATCTGCTTTTTG
ATTTTGATTTTACAAGGGATTANCATTAGATTGCATAAATCTCAGAAGAGACTTCAAACTTCAGACATCTNAGCAAGTCT
GAGACTGTTAGGGCTATGGGGAATTTTGAAGTTAGACTGAATGCATTATGACNAGGCTGGCTACAAGAGTGGAGGGGTGG
GGTGGTAN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28527525..28527771 235
 
EST/CDNA Est Name
  BX639860.1

 
Come back to gene BX639860.1


For any suggestions or comments, please send an email to unitrap@crg.es