Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11654B6
Clone ID IST11654B6
Vector VICTR76
Project tigm

Sequence tag IST11654B6HMF1
Sequence
CATTCATACATTCANACAAAGCACTCATCCACCTAAAAAGCAAAGGCTATTGCTCTGTGTGTGTTCTCTCCCCTAGTTAA
AGTAGTACCTAAATTTTTCAAGTGACAGTTAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 56101193..56101305 111
NO GENE  


Sequence tag IST11654B6HMR1
Sequence
AGGGATTNGGGTCCTCTGGCACTGAAACTATGTCCTCCACAANANTANCANGTGCTCCTAACTGCTGGGTCATTTCTCCA
GCCTCTCTGACTTTTTTAAAAGAAGAGTTTTTGCTTGTTTTGTTCTGTCTTGCTTTTATAGACCTGACTCTGACCTTAAA
TTTGTCAGGATCCTTCTGTTTCAGCGTGCTAAATGCTGAGATTACAGGCGTCC
Sequence Type genomic DNA
Unitrap ID UNI10414

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 56101341..56101551 200
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050953 (Gja1) NM_010288 gap junction protein, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:95713]

 
Come back to gene ENSMUSG00000050953


For any suggestions or comments, please send an email to unitrap@crg.es